My temples are balding rapidly and the hairline is full of painful inflamed pimples.
My doctor couldnt tell if theres any connection between the inflammation and the balding so I just got a prescription of fin.
I've been taking fin for a month now, no results. Hairloss hasn't slowed down at all, in fact I think it's a bit more rapid now.
Plus side is that I've noticed no loss of horny levels or boners whatsoever.
 |
 |
|
Sorry about your bad genetics mate.
Frick you man, this isnt "bad genetics"
Stop projecting your miserable self loathing on others who are stronger than you
I'm not the one who has MPB. My maternal and paternal ancestors had a full head of hair even in their 90s. Still a manlet though.
>Still a manlet though.
That's a LOT worse than getting a bit of widow's peak and you know it
Also, your ancestry means jack shit in the stressful 2022. Post your age, there's a chance you'll go bald in your 30s
I mean, nobody has the balls to say that The Rock has "shit genetics" because he got MPB.
Why do people call their v shaped hairlines widows peaks now, theres a difference between the genetic widows peak in the center of your hairline and the overall v shaped hairline caused by recession in the temples
I thought about this same thing a while back and realized it's simply because people in the past didn't spend 8 hours a day analyzing men's beauty like a bunch of insecure gays. So there weren't a million definitions for everything.
Male beauty standards have gone too far, I learn new stupid shit every day like the positive/negative eye tilt.
Back in the day the male hairline was just a male hairline, you weren't bald until you actually had no hair on top of your head. Now you're "bald" if your hairline isn't a mathematically straight line.
>Now you're "bald" if your hairline isn't a mathematically straight line.
That's because we understand that the cause of a V pattern is the same cause as baldness and balding for those without areata alopecia. It is simply less balding but balding nonetheless.
What is up with ugly goblins thinking theyre chads and seething at lighter skinned dudes all day? It's never the actual attractive or well adjusted medbros, always the insecure ones who look nothing like their projected caricatures
>full head of hair even in their 90s
No they don't, every man will experience some sort of balding sometime in their life.
>be perfect in everything except you have myopia
>IST incels: "shit genetics throughout"
>be perfect in everything except you start balding at 40 years old like a man should
>IST incels: "shit genetics throughout"
>be perfect in everything except you're short
>IST incels: "shit genetics throughout"
>be literal Chris Hemsworth but you have allergies in the summer
>IST incels: "shit genetics throughout"
Frick you incel. Post entire DNA or frick off.
agtagggtgtcaagcgaatggcccaccggttgctaagtccgcaggtatgcggccggtccc
cagtcgtacttcaagggagacttccaccaaccaagagcatgaaacactcgtggctaaatt
gggtgagtgagaaaccgaagctacgcccaatgctgtgcctctcgtcatacgtatattgtt
ttctggctgaagctgactaattgcaagcatactacagctgttaggtcccagggttgaggt
cgtctcgaccgggttattcgtagaggatagaaggcggcgctgcccccatttaatccgcta
cgatagttgttccgatagaaggtgaccctactagtaagagcgggattttctatatcgtat
atagcaaaccctgatctcggagggatgcatcttggtcgtatacttggttgggtacgcgaa
aaacaatctccctttagcctatctagctgtagagcgagcctcaaagcataagtgtctagg
tgactacaagatccggcagtgaccccgggctggcccgacgtaaaggacgccaatggcatg
tatgtgaatcacaaagaattacgaggccatacccacttcaatttgtttcttgcatgaagc
gttccgccaaccgcatgccgtgctatagggatcatttggcgctgtctccctagccaatga
cacaggcaagcgttcccgtggaccttgctccccacccaataagtttacatcgccgaaagg
agcttatacagagccaccgcagcatgcacggaagaggggagttcgtgcgccactcagcta
tctccttattcccgttaattcctaataggtagactacgaagtgattcgaacgacttatgg
gctgggactctatgctccggtgaacgctacgttgccctcctcgggctgtctaggttacac
tcactcgaccaaattttagccttactaagcgctctaccccggctcaccttagtcagatgc
ctggcctgacccagcaacgagaacggcgcttattgccccgcggaactatccgatcaatga
ggacggacagaaccgctctccgatcccactggaggtacacactgccctcgtgcccgccgg
gaagagcttggtcggctgctcttcaattacttggtaagttttatctgctgctcctttccg
caatcgactatagtccgagtcttcatacgcgctggccggcaaggtgagggcattcgatgc
ccgaactatcagattgatcagctggtcttcaatgcgagtgtttcgtggtgcgcaatctta
tctgatcacgactacataaggcggttcgacgactgtcacagctcgacaaacagttacaac
aaatggtaaccgggcacacgggttgctagtgatgcggcgtaggaccgtgttctggagttt
ttccgtcttgaaccgtccttggattgggtgcgatcgtcaatcgaattttcttggacatcc
ttagaatcatattatgatacacacaaagtatgccggaccgcatctggcaggaccacctgg
cggtggggggtcgcgactgatatgcgtctctaaatcgcgcaccgcactttacgccgagca
tgagttgctaatttattcggcagaagcgctagtcgctattccacctaggtgagagccgaa
ccacagctaaccgaccatcaattatgaccgagtatgttctgtggcagcgtccaacagctg
ccgttgcggtgcgagcatggcggattcaatggcggtaagtgcaagctgccgccaccggga
ccccccgttgcatattaagcgtagctcgggttgaaactactatccaggttgtatacaata
taccaaattggggccgtacctcgcgtgatagatgagggcttgagtaatagttgtggagat
gactataaaggttccatccacaggacgacccccggaaccctatattggagaggcaggcgc
gaatcactagtcccccgattaatgtaaccc
>ttggcgctgtctccctagccaatga
>cacaggcaagcgttcccgtggaccttgctccccacccaataagtttacatcgccgaaa
oh nONONONOOO hHAHAHAHAHAHA
microneedling + fix ur diet
>for a month now, no results
I don’t believe you see anything noticeable until somewhere between 6 months and a year. I’m also a month into taking fin, stick with it anon. If you see no results after a year then just drop it.
Thanks anon. This just makes me think I should've started a year ago haha
>doctor couldnt tell if theres any connection between the inflammation and the balding
your doctor is a lazy moron and just wanted to give you pills to make you go away and not have to figure out the real problem
How to stop scalp pimples?
>be on finasteride for 7 months
>don’t see much improvement
>hop on dutasteride
>been shedding like crazy for 3 weeks straight, easily 50+ hairs in the shower
>scalp starting to become visible in crown area, front of hairline thinning rapidly
Should I keep riding this shed out? How bad would it be to switch back to finasteride?
>don’t see much improvement
Tbh I don't think finasteride is gonna show much visual progress, it's more used for putting on the brakes of hairloss. You should be using something like minoxidil if you want to get back ground.
>a month
Takes like a year of fin to show real benefits.
If it's causing a shed that means it's working, generally.
However, if dut doesn't work there's no point going back to fin since dut is just more potent fin.
Dut is spiking t causing you to shed, you need a topical antiandrogen with it
it took me 4 months until the shedding stopped. I retained my current hairline.
It takes up to a year on fin to see regrowth, the making it worse thing is just you hyper focused on your hair/ or you are having a shedding phase which is normal. Wagmi. Don’t become a chrome dome.
I switched form oral fin to a finoxidil/minasteride topical homebrew 0.05% concentration about three weeks ago. Far too early to tell if it's going to have positive benefits unfortunately, but I've been feeling that "balding itch" which makes me think it's not working and my hair's getting DHT fricked again.
But then, minoxidil can cause itchiness as well, so I dunno. All I can do is see if I go bald doing it. Taking oral fin fricked my system up and made my morning wood disappear.
I wouldn't care about the hair much if it weren't for the fact I'd have to basically give up banging hot college girls.
Fin will never hurt your penis and the people who hate keep using this myth are evil
It will, and it may even hurt your balls.
Wow what a funny picture. Updooted! 🙂